Informasjon

Hvorfor skrives prokaryote promotorsekvenser 5 'til 3', når transkripsjonen fortsetter fra 3 'til 5'?

Hvorfor skrives prokaryote promotorsekvenser 5 'til 3', når transkripsjonen fortsetter fra 3 'til 5'?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Det ser ut til at promotorregionene er skrevet fra 5 'til 3' retningen. Forelesningsnotatene mine gir for eksempel -35 og -10 promoterregioner sekvenser slik:

Wikipedia ser ut til å være enig i artikkelen om promotører.

Imidlertid transkriberer RNA -polymerase i 3 'til 5', som i den leser malstrengen i 3 'til 5' retning. I så fall, hvorfor er ikke promoterregionene også skrevet i 3- til 5 -retningen?

Betydning, i stedet for at sekvensen -10 er5'-TATAAT-3 ', hvorfor er det ikke det3'-ATATTA-5 ', i samsvar med retning av transkripsjon?

Mitt intuitive gjetning er at $ sigma $ -faktoren gjenkjenner promotorregionen i en 5 'til 3' retning. Men jeg kan ikke finne informasjon som støtter dette gjetningen. I tillegg, hvis dette er sant, hvordan kunne det ha blitt bestemt (eksperimentelt)? Uansett, hva svaret er, gjelder det også transkripsjon i eukaryoter?


DNA -sekvens etter konvensjon skrives med start ved 5' -stillingen, så retningsbestemmelsen antas uten å skrive 5 'og 3' eksplisitt. Når det gjelder hvorfor det ikke er malstrengsekvensen. Jeg vil si at det også er en konvensjon for enkelhet fordi du bare trenger å skrive en sekvens hvis du vil diskutere gener og regulatoriske elementer.


Start av transkripsjon i prokaryoter

Prokaryoter har ikke membranomsluttede kjerner. Derfor kan prosessene med transkripsjon, oversettelse og mRNA -nedbrytning skje samtidig. Det intracellulære nivået av et bakterielt protein kan raskt forsterkes ved flere transkripsjon og oversettelseshendelser som skjer samtidig på den samme DNA -malen. Prokaryot transkripsjon dekker ofte mer enn ett gen og produserer polykistroniske mRNA som spesifiserer mer enn ett protein.

Diskusjonen vår her vil eksemplifisere transkripsjon ved å beskrive denne prosessen i Escherichia coli, en godt studert bakterieart. Selv om det er noen forskjeller mellom transkripsjon i E coli og transkripsjon i archaea, en forståelse av E coli transkripsjon kan brukes på praktisk talt alle bakteriearter.


Biologi 171

Ved slutten av denne delen vil du kunne gjøre følgende:

  • Nevn de forskjellige trinnene i prokaryot transkripsjon
  • Diskuter promotorers rolle i prokaryot transkripsjon
  • Beskriv hvordan og når transkripsjonen avsluttes

Prokaryotene, som inkluderer Bakterier og Archaea, er stort sett encellede organismer som per definisjon mangler membranbundne kjerner og andre organeller. Et bakteriekromosom er en lukket sirkel som, i motsetning til eukaryote kromosomer, ikke er organisert rundt histonproteiner. Den sentrale delen av cellen der prokaryot DNA befinner seg kalles nukleoidregionen. I tillegg har prokaryoter ofte rikelige plasmider, som er kortere, sirkulære DNA -molekyler som bare kan inneholde ett eller noen få gener. Plasmider kan overføres uavhengig av bakteriekromosomet under celledeling og har ofte egenskaper som de som er involvert i antibiotikaresistens.

Transkripsjon i prokaryoter (og i eukaryoter) krever at DNA -dobbeltspiralen delvis slapper av i mRNA -synteseområdet. Området for avvikling kalles en transkripsjonsboble. Transkripsjon fortsetter alltid fra den samme DNA -strengen for hvert gen, som kalles malstrengen. MRNA -produktet er komplementært til malstrengen og er nesten identisk med den andre DNA -strengen, kalt den ikke -benyttede strengen, eller den kodende strengen. Den eneste nukleotidforskjellen er at i mRNA blir alle T -nukleotidene erstattet med U -nukleotider ((figur)). I en RNA dobbelt helix kan A binde U via to hydrogenbindinger, akkurat som i A -T sammenkobling i en DNA dobbel helix.


Nukleotidparet i DNA -dobbeltspiralen som tilsvarer stedet der det første 5 ′ mRNA -nukleotidet blir transkribert, kalles +1 -stedet, eller initieringsstedet. Nukleotider før initieringsstedet er betegnet med "-" og er angitt oppstrøms nukleotider. Motsatt er nukleotider som følger initieringsstedet betegnet med "+" nummerering og kalles nedstrøms nukleotider.

Start av transkripsjon i prokaryoter

Prokaryoter har ikke membranomsluttede kjerner. Derfor kan prosessene med transkripsjon, oversettelse og mRNA -nedbrytning skje samtidig. Det intracellulære nivået av et bakterielt protein kan raskt forsterkes ved flere transkripsjon og oversettelseshendelser som skjer samtidig på den samme DNA -malen. Prokaryote genomer er veldig kompakte, og prokaryote transkripsjoner dekker ofte mer enn ett gen eller cistron (en kodende sekvens for et enkelt protein). Polykistroniske mRNA blir deretter oversatt til å produsere mer enn én type protein.

Diskusjonen vår her vil eksemplifisere transkripsjon ved å beskrive denne prosessen i Escherichia coli, en godt studert eubakteriell art. Selv om det er noen forskjeller mellom transkripsjon i E coli og transkripsjon i archaea, en forståelse av E coli transkripsjon kan brukes på praktisk talt alle bakteriearter.

Prokaryotisk RNA -polymerase

Prokaryoter bruker samme RNA -polymerase for å transkribere alle genene deres. I E coli, består polymerasen av fem polypeptidunderenheter, hvorav to er identiske. Fire av disse underenhetene, betegnet α, α, β, og β‘, omfatter polymerase -kjerneenzymet. Disse underenhetene samles hver gang et gen transkriberes, og de demonteres når transkripsjonen er fullført. Hver underenhet har en unik rolle de to α-enheter er nødvendige for å montere polymerasen på DNA β-enhet binder seg til ribonukleosidtrifosfatet som vil bli en del av det begynnende mRNA -molekylet og β‘ -underenhet binder DNA -malstrengen. Den femte underenheten, σ, er bare involvert i transkripsjonsstart. Det gir transkripsjonell spesifisitet slik at polymerasen begynner å syntetisere mRNA fra et passende initieringssted. Uten σ, ville kjerneenzymet transkribere fra tilfeldige steder og ville produsere mRNA -molekyler som spesifiserte proteingummi. Polymerasen som består av alle fem underenhetene kalles holoenzym.

Prokaryote promotører

En promoter er en DNA -sekvens som transkripsjonsmaskineriet, inkludert RNA -polymerase, binder og starter transkripsjon på. I de fleste tilfeller eksisterer promotører oppstrøms for genene de regulerer. Den spesifikke sekvensen til en promoter er veldig viktig fordi den bestemmer om det tilsvarende genet transkriberes hele tiden, noen ganger, eller sjelden. Selv om promotører varierer mellom prokaryote genomer, er noen få elementer evolusjonært konservert hos mange arter. På -10 og -35 -områdene oppstrøms initieringsstedet er det to promotors konsensus -sekvensereller regioner som er like på tvers av alle promotorer og på tvers av forskjellige bakteriearter ((figur)). -10 -sekvensen, kalt -10 -regionen, har konsensus -sekvensen TATAAT. -35 -sekvensen har konsensus -sekvensen TTGACA. Disse konsensus -sekvensene blir gjenkjent og bundet av σ. Når denne interaksjonen er gjort, binder underenhetene til kjerneenzymet seg til stedet. A -T -rich -10 -regionen letter avvikling av DNA -malen, og flere fosfodiesterbindinger dannes. Transkripsjonens initieringsfase avsluttes med produksjon av abortive transkripsjoner, som er polymerer av omtrent 10 nukleotider som lages og frigjøres.


Se transkripsjonen (video – Walter & amp; Eliza Hall) for å se den første delen av transkripsjonen og basesekvensrepetisjonen av TATA -boksen.

Forlengelse og avslutning i prokaryoter

Transkripsjonsforlengelsesfasen begynner med utgivelsen av σ underenhet fra polymerasen. Dissosiasjonen av σ lar kjerneenzymet fortsette langs DNA -malen og syntetisere mRNA i 5 ′ til 3 ′ retningen med en hastighet på omtrent 40 nukleotider per sekund. Etter hvert som forlengelsen fortsetter, rulles DNA kontinuerlig ut foran kjerneenzymet og spoles tilbake bak det. Baseparringen mellom DNA og RNA er ikke stabil nok til å opprettholde stabiliteten til mRNA -syntesekomponentene. I stedet fungerer RNA -polymerasen som en stabil linker mellom DNA -malen og de begynnende RNA -strengene for å sikre at forlengelsen ikke avbrytes for tidlig.

Prokaryote termineringssignaler

Når et gen er transkribert, må den prokaryote polymerasen instrueres til å dissosiere fra DNA -malen og frigjøre det nylagde mRNA. Avhengig av genet som blir transkribert, er det to typer avslutningssignaler. Den ene er proteinbasert og den andre er RNA-basert. Rho-avhengig avslutning styres av rho-proteinet, som følger med bak polymerasen på den voksende mRNA-kjeden. Nær slutten av genet, møter polymerasen en kjøring av G -nukleotider på DNA -malen, og den går i stå. Som et resultat kolliderer rho -proteinet med polymerasen. Interaksjonen med rho frigjør mRNA fra transkripsjonsboblen.

Rho-uavhengig avslutning kontrolleres av spesifikke sekvenser i DNA-malstrengen. Når polymerasen nærmer seg slutten av genet som blir transkribert, møter den en region rik på C - G -nukleotider. MRNA bretter seg tilbake på seg selv, og de komplementære C -G -nukleotidene binder seg sammen. Resultatet er en stabil hårnål som får polymerasen til å stoppe når den begynner å transkribere et område rikt på A -T -nukleotider. Den komplementære U - A -regionen til mRNA -transkripsjonen danner bare en svak interaksjon med mal -DNA. Dette, kombinert med den stoppede polymerasen, induserer nok ustabilitet til at kjerneenzymet kan bryte vekk og frigjøre det nye mRNA -transkriptet.

Ved avslutning er transkripsjonsprosessen fullført. Når avslutningen skjer, ville det prokaryote transkriptet allerede blitt brukt til å begynne syntese av mange kopier av det kodede proteinet fordi disse prosessene kan forekomme samtidig. Foreningen av transkripsjon, translasjon og til og med mRNA -nedbrytning er mulig fordi alle disse prosessene skjer i samme 5 ′ til 3 ′ retning, og fordi det ikke er noen membranøs oppdeling i den prokaryote cellen ((figur)). I kontrast utelukker tilstedeværelsen av en kjerne i eukaryote celler samtidig transkripsjon og translasjon.


Se transkripsjon (video og#8211 ndsuvirtualcell) for å se prosessen med prokaryot transkripsjon.

Avsnittssammendrag

I prokaryoter initieres mRNA -syntese ved en promotorsekvens på DNA -malen som omfatter to konsensus -sekvenser som rekrutterer RNA -polymerase. Den prokaryote polymerasen består av et kjerneenzym av fire proteinunderenheter og a σ protein som bare hjelper ved initiering. Forlengelse syntetiserer mRNA i 5 ′ til 3 ′ retningen med en hastighet på 40 nukleotider per sekund. Terminering frigjør mRNA og skjer enten ved rho -proteininteraksjon eller ved dannelse av en mRNA -hårnål.

Gratis svar

Hvis mRNA er komplementær til DNA -malstrengen og DNA -malstrengen er komplementær til DNA -ikke -modellstrengen, hvorfor er så ikke basesekvenser av mRNA og DNA -ikke -modellstrengen ikke identiske? Kan de noen gang være det?

DNA er forskjellig fra RNA ved at T -nukleotider i DNA er erstattet med U -nukleotider i RNA. Derfor kunne de aldri være identiske i basesekvensen.

Med dine egne ord, beskriv forskjellen mellom rho-avhengig og rho-uavhengig avslutning av transkripsjon i prokaryoter.

Rho-avhengig avslutning styres av rho-proteinet, som sporer langs bak polymerasen på den voksende mRNA-kjeden. Nær slutten av genet, stopper polymerasen ved en kjøring av G -nukleotider på DNA -malen. Rho -proteinet kolliderer med polymerasen og frigjør mRNA fra transkripsjonsboblen. Rho-uavhengig avslutning kontrolleres av spesifikke sekvenser i DNA-malstrengen. Når polymerasen nærmer seg slutten av genet som blir transkribert, møter den en region rik på C - G -nukleotider. Dette skaper en mRNA -hårnål som får polymerasen til å stoppe helt når den begynner å transkribere et område rikt på A -T -nukleotider. Fordi A -U -bindinger er mindre termostabile, faller kjerneenzymet bort.

Et fragment av bakterielt DNA lyder:

3 ’–TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

Forutsatt at dette fragmentet er malstrengen, hva er sekvensen til mRNA som ville bli transkribert? (Tips: Sørg for å identifisere startstedet.)

Ved å undersøke DNA -sekvensen kan vi se at det er en -10 konsensus -sekvens nær 3' -enden av fragmentet. Hvis vi deretter teller nedstrøms, er +1 initieringsstedet T umiddelbart etter sekvensen AAT. Dette betyr at DNA -fragmentet som vil fungere som mal for transkripsjon har sekvensen TGATAGAAGCACTCTAC. MRNA laget av denne malen vil ha gratis baseparring med uracil (U) i stedet for tymin (T). Dette gir oss ACUAUCUUCGUGAGAUG som den transkriberte mRNA -sekvensen.

Ordliste


Studienotater om transkripsjon i prokaryoter | Cellebiologi

I prokaryote organismer forekommer transkripsjon i tre faser kjent som initiering, elon og shygasjon og avslutning ved hjelp av enkelt RNA -polymerase.

RNA syntetiseres av et enkelt RNA -polymeraseenzym som inneholder flere polypeptidunderenheter.

I E. coli har RNA -polymerasen fem underenheter:

to a, en p, en P ’ og en en underenhet (α2ββ’σ). Denne formen kalles holoenzym. Σ -underenheten kan skilles fra og skille seg fra de andre underenhetene for å etterlate en form kjent som kjerneenzymet.

Disse to former for RNA -polymerase har forskjellige roller i transkripsjon. Subenheten σ kreves for interaksjon og skyggehandling med sigmafaktoren. Sigma -faktoren gjenkjenner startsignalet til DNA og dirigerer enzymets binding til initieringsstedet på DNA -malen. Bindingen av RNA -polymerase til DNA involverer β -underenheten.

Initiering innebærer binding av RNA -polymerase til promotersetet.

Promoter -nettsted for initiering:

Transkripsjon kan ikke starte tilfeldig, men må begynne spesielt ved starten av et gen. Signaler for initiering av transkripsjon forekommer i promotorsekvensen som ligger direkte oppstrøms for den transkriberte sekvensen til genet.

Promotoren inneholder spesifikke DNA -sekvenser som fungerer som festepunkter for RNA -polymerasen. De eksakte sekvensene kan variere mellom promotorer, men er i samsvar med et overordnet mønster kjent som konsensus -sekvensen.

I E. Coli gjenkjennes to sekvenselementer, -10 sekvens og -35 sekvens, av RNA -polymerasen. Consen & shysus -10 sekvensen, også kalt “Beskriv boksen ” er TATAAT og konsensus -35 sekvensen, også kalt “gjenkjenningssekvens ” er TTGACA. (Fig. 16.2).

Σ -underenheten til RNA -polymerasen er ansvarlig for å gjenkjenne og binde promotoren, sannsynligvis ved boksen -35. I fravær av σ -underenheten kan enzymet fortsatt binde seg til DNA, men bindingen er mer tilfeldig.

Oppstart av RNA -syntese:

Når enzymet binder seg til promotoren, danner det i utgangspunktet et lukket promoterkompleks der promotor -DNA forblir som en dobbel helix. Enzymet dekker omtrent 60 basepar av promotoren inkludert boksene -10 og -35.

For å la transskripsjon begynne, dissosierer dobbelthelixen delvis ved -10 -boksen, som er rik på svake AT -bindinger, for å gi et åpent promotorkompleks. Σ -underenheten dissosierer deretter fra det åpne promoterkomplekset og forlater kjerneenzymet. Samtidig binder de to første ribonukleotidene seg til DNA, den første fosfodiesterbindingen dannes og transkripsjon initieres (figur 16.3).

Under forlengelse beveger RNA -polymerasen seg langs DNA -molekylet, smelter og vikler ut den dobbelte helixen etter hvert som den utvikler seg. Enzymet tilfører ribonukleotider til 3 ′ -enden av det voksende RNA -molekylet med rekkefølgen av tilsetning bestemt av rekkefølgen på basene på malstrengen.

I de fleste tilfeller blir en ledersekvens av variabel lengde transkribert før kodingssekvensen til genet er nådd. På samme måte, på slutten av den kodende sekvensen, blir en ikke -kodende trailersekvens transskrevet og shikribert før transkripsjonen slutter. Under transkripsjon rulles bare en liten del av den dobbelte helixen av gangen.

Det avviklede området inneholder den nylig syntetiserte RNA-basen paret med malen DNA-streng og strekker seg over 12-17 baser. Det avviklede området må forbli lite fordi avvikling i ett område krever overvikling i tilstøtende områder, og dette påfører DNA -molekylet belastning.

For å unngå og slippe dette problemet, frigjøres RNA fra DNA -malen mens det syntetiseres slik at DNA -dobbelheliksen kan reformere (fig. 16.4).

Kjedeforlengelse skjer ved tilsetning av aktiverte ribonukleosidtrifosfater (ATP, UTP, GTP og CTP) til en streng av DNA -malen. For hvert nukleotid som tilsettes den voksende RNA -kjeden, avgis pyrofosfat (PPi). Dette hydrolyseres raskt til uorganiske phos og shyphate (Pi).

Syntesen av RNA -kjeden drives av energiforbruk i form av pyrofosfater. For hver nukleotid -mono og -sky som tilsettes kjeden, brukes to høyenergifos og shyphater.

Hele reaksjonen kan oppsummeres som følger:

Forlengelse av RNA -kjeden skjer ved hjelp av kjerneenzymet som beveger seg langs DNA -malen. Under transkripsjon syntetiseres RNA ved polymerisering av ribonu- og shycleotidtrifosfatunderenheter (ATP, UTP, GTP, CTP).

3 ′-OH av ett ribonukleotid reagerer med 5 ′ fosfatet til et annet for å danne en fosfodiesterbinding. Transkripsjonen blir syntetisert og shysisert i 5 ′ → 3 ′ retningen, men fordi kjeden må være parallell for baseparring, kjører malstrengen i motsatt, 3 ’ → 5 ′ retning.

RNA -kjeder vokser i 5 ’ → 3 ′ retningen:

Hvis RNA -kjeder syntetiseres i 5 ’ → 3 ′ retningen, bør det første nukleotidet ha trifosfatgruppe (P

P). Hvis derimot kjeden vokser i 3 ’ → 5 ′ retningen, så vil trifosfatgruppen være på nukleotidet i den voksende enden. Det er funnet at trifosfatgruppen er festet til det første nukleotidet ved 5 ′ enden og en fri hydroksylgruppe i 3 ′ enden.

Dette viser at veksten skjer i 5 ′ → 3 ′ retningen.

Bare én DNA -streng av et gen transkriberer mRNA:

I dobbeltstrenget DNA transkriberes et gitt gen fra en av de to strengene. Det transkriberte RNA komplementerer bare en av de to trådene. Alle de transkriberte genene trenger imidlertid ikke å være på en streng av DNA -dobbelheliksen.

Ett gen kan transkribere mRNA fra en streng mens et annet transkriberer fra den andre strengen. De to trådene eller den dobbelte helixen kalles malen og de ikke-malstrengene. RNA produseres ved hjelp av malstrengen og RNA-molekylet syntetisert og shysized er en kopi av den ikke-malstrengen (figur 16.5), også kalt sense (+) -strengen eller den kodende tråden. RNA -molekylet som er syntetisert kalles et transkripsjon.

Avslutningen av transkripsjon og shytion skjer ikke-tilfeldig og tar på bestemte punkter etter slutten av kodingssekvensen. I E. coli skjer avslutning ved sekvenser kjent som palindromer. Disse er symmetriske omtrent på midten slik at første halvdel av sekvensen blir fulgt av det eksakte komplementet i andre halvdel.

I enkeltstrengede RNA-molekyler tillater denne funksjonen den første halvdelen av sekvensen å basere par med andre halvdel for å danne det som kalles en stamme-sløyfestruktur (figur 16.6). Disse ser ut til å fungere som signaler for termina og shytion. I noen tilfeller blir stamsløyfesekvensen fulgt av et løp på 5-10. Som i DNA-en som danner svake A-U-basepar med det nylig synkroniserte og shytesiserte RNA.

Det antas at RNA poly & shymerase stopper like etter stamsløyfen, og at de svake A-U-baseparene brytes og forårsaker at trans og shycript løsner fra malen.

I andre tilfeller er kjøringen av As fraværende, og en annen mekanisme oppstår basert på binding av et protein kalt Rho (p) som forstyrrer baseparring mellom tem & shyplate og transkripsjon når polymerasen stopper etter stamsløyfen. Avslutningen av transkripsjonen innebærer frigjøring av transkripsjonen og kjerneenzymet som deretter kan assosiere seg med o-underenheten og fortsette til en annen runde med transkripsjon.


Forlengelse

Etter hvert som forlengelsen fortsetter, rulles DNA kontinuerlig ut av kjerneenzymet ettersom hydrogenbindingene som forbinder de komplementære baseparene i DNA -dobbelheliksen brytes (figur 2). DNA blir spolet bak kjerneenzymet etter hvert som hydrogenbindinger reformeres. Baseparringen mellom DNA og RNA er ikke stabil nok til å opprettholde stabiliteten til mRNA -syntesekomponentene. I stedet fungerer RNA -polymerasen som en stabil linker mellom DNA -malen og den nydannende RNA -strengen for å sikre at forlengelsen ikke avbrytes for tidlig.

Figur 2 Under forlengelse sporer RNA -polymerase langs DNA -malen, syntetiserer mRNA i 5 ′ til 3 ′ retningen, og spoler av og spoler deretter DNAet tilbake mens det leses.


Prokaryote termineringssignaler

Når et gen er transkribert, må den prokaryote polymerasen instrueres til å dissosiere fra DNA -malen og frigjøre det nylagde mRNA. Avhengig av genet som blir transkribert, er det to typer avslutningssignaler. Den ene er proteinbasert og den andre er RNA-basert. Rho-avhengig avslutning styres av rho-proteinet, som sporer langs bak polymerasen på den voksende mRNA-kjeden. Nær slutten av genet, møter polymerasen en kjøring av G -nukleotider på DNA -malen, og den går i stå. Som et resultat kolliderer rho -proteinet med polymerasen. Interaksjonen med rho frigjør mRNA fra transkripsjonsboblen.

Rho-uavhengig avslutning kontrolleres av spesifikke sekvenser i DNA-malstrengen. Når polymerasen nærmer seg slutten av genet som blir transkribert, møter den en region rik på C - G -nukleotider. MRNA bretter seg tilbake på seg selv, og de komplementære C -G -nukleotidene binder seg sammen. Resultatet er en stabil hårnål som får polymerasen til å stoppe når den begynner å transkribere et område rikt på A -T -nukleotider. Den komplementære U -A -regionen til mRNA -transkripsjonen danner bare en svak interaksjon med mal -DNA. Dette, kombinert med den stoppede polymerasen, induserer nok ustabilitet til at kjerneenzymet bryter vekk og frigjør det nye mRNA -transkriptet.

Ved avslutning er transkripsjonsprosessen fullført. Når avslutningen skjer, ville det prokaryote transkriptet allerede blitt brukt til å begynne syntese av mange kopier av det kodede proteinet fordi disse prosessene kan forekomme samtidig. Foreningen av transkripsjon, translasjon og til og med mRNA -nedbrytning er mulig fordi alle disse prosessene skjer i samme 5 ′ til 3 ′ retning, og fordi det ikke er noen membranøs oppdeling i den prokaryote cellen ([lenke]). I kontrast utelukker tilstedeværelsen av en kjerne i eukaryote celler samtidig transkripsjon og translasjon.



Besøk denne BioStudio -animasjonen for å se prosessen med prokaryot transkripsjon.


Oversikt over transkripsjon

Transkripsjon er den første fasen av ekspresjon av gener til proteiner. Ved transkripsjon blir et mRNA (messenger RNA) mellomprodukt transkribert fra en av strengene i DNA -molekylet. RNA kalles messenger RNA fordi det bærer "meldingen", eller genetisk informasjon, fra DNA til ribosomene, hvor informasjonen brukes til å lage proteiner. RNA og DNA bruker komplementær koding der basepar passer sammen, på samme måte som DNA -strengene binder seg for å danne en dobbel helix.

En forskjell mellom DNA og RNA er at RNA bruker uracil i stedet for tyminet som brukes i DNA. RNA -polymerase formidler fremstilling av en RNA -streng som utfyller DNA -strengen. RNA syntetiseres i 5 ' -& gt 3' -retningen (sett fra det voksende RNA -transkriptet). Det er noen korrekturlesningsmekanismer for transkripsjon, men ikke så mange som for DNA -replikasjon. Noen ganger oppstår kodingsfeil.


1. Introduksjon

Tempoet der hele genomene sekvenseres, er langt foran det for genomets sekvenskommentering, enn si en molekylær forståelse av genomorganisasjonen. Sammenlignet med eksperimentelle tilnærminger, tilbyr beregningsverktøy et raskere alternativ for påliteligheten til sekvenskommentarer som i stor grad bestemmes av deres forsiktige design, som igjen er avhengig av en rettferdig forståelse av de berørte molekylære mekanismene.

En av de mest ettertraktede oppgavene i genomkommentarer er identifisering av promoterregioner, ikke bare for validering av forutsagte gener og identifikasjon av nye gener, men også for å forstå transkriptomiske regulatoriske nettverk (med hensyn til promoterplassering og arkitektur). I løpet av de første årene med sekvensakkumulering ble promotoridentifikasjon sett på som en triviell oppgave på grunn av visse eksperimentelt avledede sekvensinformasjonsregler (Pribnow, 1975). For hvert år som har gått har det imidlertid dukket opp som en av de mest skremmende utfordringene i genomkommentarer. Genomiske sekvenser i prokaryoter er svært tilpasningsdyktige i genomer og svært diversifiserte på tvers av arter for å muliggjøre deres overlevelse under forskjellige og ekstreme forhold. Dette gjør det vanskelig å oppdage bevarte reguleringssteder ved sekvenshomologi. Videre gjør variasjon i lengden på 5 ′ ikke -oversatte regioner og tilstedeværelse av flere transkripsjonelle startsteder (TSS) det ikke åpenbart å lete etter promotorer i den umiddelbare oppstrømsregionen av den kommenterte kodende sekvensen. Kompleksiteten blir ytterligere forsterket av høye gentettheter, med tilstøtende gener som generelt har svært korte intergeniske mellomrom eller i noen tilfeller har overlappende kodende regioner. Nylige rapporter om gjennomgripende transkripsjon, hvor transkripsjon kan starte fra et hvilket som helst sted, har ytterligere utdypet mysteriet (Wade og Grainger, 2014).

Mange anstrengelser har blitt gjort for å utvikle effektive verktøy for prediksjon av prediktører, basert på forskjellige logikker. Sekvensbaserte beregningsmetoder for promoter prediksjon har vært moderat vellykket (Dekhtyar et al., 2008 Jacques et al., 2006), selv om maskinlæring på enorme treningsdata for promotorsekvenser har ført til noen gode prediktive, men sterkt genomspesifikke verktøy (de Jong et al., 2012 av Silva et al., 2011 Lai et al., 2019 Shahmuradov et al., 2016 Solovyev og Salamov, 2011 Umarov og Solovyev, 2017 Umesh et al., 2014). I det siste har det også blitt gitt oppmerksomhet for å fange de strukturelle og/eller energiske signalene fra promoterregioner. Noen av de strukturelle og/eller energiske egenskapene som brukes til promoterforutsigelse, er bøybarhet, krumning, mellom-basepar (BP) -egenskaper, fri energi, A-filisitet og stressindusert DNA-dupleksdestabilisering blant andre (Abeel et al., 2008 Florquin et al., 2005 Goñi et al., 2007 Rangannan og Bansal, 2010 Wang og Banham, 2006). DNA -form bestemt av fire forskjellige trekk - mindre lundbredde, propellvridning, rull og spiralformet vridning - har vist seg å være viktige determinanter for identifisering av transkripsjonsfaktorbindingssteder (TFB) og TSS (Chiu) et al., 2015 Levo et al., 2015 Zhou et al., 2013, 2015). Disse studiene fastslår utvilsomt at tredimensjonal struktur av DNA, utover den primære sekvensen, er en determinant for protein -DNA -bindingsspesifisitet. Til tross for de mange innsiktene som følger av slike studier gjennom årene, er det fremdeles ventet på utvikling av et verktøy for forutsigelse av promotorer som gir høy ytelse. Det er tydelig at de eksisterende konseptuelle rammene ikke er tilstrekkelige ennå til å forstå arten av promotorsignaler fullt ut. Det er behov for å utvikle nye ideer/modeller for å forklare finjusteringen av strukturell og energitilstand til promotorsekvens med hensyn til samspillende protein/transkripsjonsfaktorer/ligander.

Begrunnelse: Målet var å utvikle en ny modell for å fange strukturernes og energistatusen til promotorer. For strukturell karakterisering, i stedet for å ta DNA-form (den kumulative effekten av forskjellige parametere), bestemte vi oss for å bruke alle individuelle parametere (28 totalt) som er involvert i romlig organisering av basene og BP-trinn-ryggrad organisering, mellom-BP arrangementer, intra-BP arrangementer og den relative posisjoneringen med hensyn til BP-aksen. Begrunnelsen var å ha en bred horisont for å finne ny informasjon. Strukturell analyse ble styrt av noen gjennombruddsstudier i analysen av nukleinsyrestrukturer i løpet av de siste tiårene (Beveridge et al., 2004, 2012 Dixit et al., 2005 Hassan og Calladine, 1995 Lavery et al., 2009, 2010 Olson et al., 1998 Pasi et al., 2014 Yanagi et al., 1991). For energikarakterisering stolte vi på vår egen erfaring. Vi har gjort en innsats for å forstå DNA -språket når det gjelder energien de siste 15 årene og har oppnådd beskjeden suksess i prosessen. I denne serien har vi rapportert at hydrogenbinding, stabling og løsningsenergi viser tydelige signaturer av funksjonelle skjebner for DNA -sekvenser (Dutta et al., 2006 Khandelwal et al., 2012, 2014 Khandelwal og Bhyravabhotla, 2010 Khandelwal og Jayaram, 2012 Singh et al., 2017 Singhal et al., 2008). Så med 31 parametere (20 strukturelle og 3 energi) karakteriserte vi 16 519 primære prokaryote promotorsekvenser (Mishra et al., 2018). Det ble funnet at alle parametere gir et signatsignal ved/nær TSS, og informasjonen for dette signatsignalet er innebygd i promotorsekvenser. Kraften til en nøyaktig modell ligger ikke bare i dens evne til å forklare, men også til å forutsi nøyaktig. Hvis denne strukturelle og energiske modellen for promotører er nøyaktig, bør den føre til et pålitelig promoter -prediksjonsverktøy med en uvanlig evne til effektivt og nøyaktig å forutsi de prokaryote promotorene uavhengig av genom/art. Med dette målet ledet vi vår innsats for å utvikle en passende promoter -prediksjonsalgoritme fra de 31 parametrene ved å bruke forskjellige statistiske teknikker. Her presenterer vi en ny metode, SEProm, som er gjeldende for alle prokaryoter inkludert archaea og utfører betraktelig godt i sammenligning med de tilgjengelige promoterforutsigelsesprogrammene. Verktøyet kan lastes ned fritt med enkle instruksjoner.


Hvorfor skrives prokaryote promotorsekvenser 5 'til 3', når transkripsjonen fortsetter fra 3 'til 5'? - Biologi

Hva er et gen? På et nivå er et gen en ordnet streng av nukleotider som koder for et polypeptid. Slike gener er "strukturelle" gener. Vi vet også at gener også kan kode RNA, inkludert messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA) så vel som andre RNA -typer. Men noe må slå på og avslutte genuttrykk, samt regulere det. De regulatoriske sekvensene, som kan være & quot; promotorer & quot; eller & quotenhancers/silencers & & quot; kan være lokalisert langt borte fra kodingsområdene. Så nå må vårt syn på et gen inkludere ideen om separate områder av et kromosom. Hva om informasjonen som transkribert til mRNA ikke gjenspeiler det endelige proteinet før det er endret ytterligere? Dette er & quotposttranscriptional modification & quot. Nå blir konseptet med et gen enda mer overskyet. Hva om det er & quotoverlapping & quot -kodende regioner? Vår definisjon av et gen kommer tydeligvis ikke til å være enkel.

Funksjonelt kan vi imidlertid beskrive et gen som å ha en distinkt kodende region og en distinkt regulatorisk region, sistnevnte kontrollerer hastigheten med hvilken DNA blir transkribert til mRNA. Vi vil se at de regulatoriske enhetene er sammensatt av DNA & quotmotiver & quot, og at hvert motiv må opptas av en regulatorisk protein hvis et gen skal reguleres skikkelig. Det må ikke bare være passende festing av proteinet, men proteinene må alle passe sammen med proteiner som binder seg til andre motiver i nærheten på den måten som puslespillbitene passer sammen. Og det er bare en riktig måte for alt å passe sammen. Så det er ikke bare et enkelt spørsmål om DNA -styring av mRNA -syntese, som deretter dirigerer proteinsynteseproteiner er iboende involvert i reguleringen av proteinproduksjon på transkripsjonsnivå. Dette kan bli et mareritt hvis du begynner å tenke på regulering av produksjonen av regulatoriske proteiner.

Vi må også vurdere en viktig forskjell mellom eukaryoter og prokaryoter med hensyn til transkripsjon av strukturelle eller proteinkodende gener. I eukaryoter transkriberes genene individuelt, mens i prokaryoter kan gener med relaterte funksjoner (& quotoperons & quot) transkriberes sammen. Som et eksempel inkluderer Lac-operonet tre proteinkodende gener så vel som deres kontrollsekvenser. Operonet er transkribert som en enkelt enhet som et "polycistronisk mRNA". Eukaryote strukturelle gener transkriberes som monocistronisk mRNA.

DNA-rettet RNA-syntese

There are three steps that characterize DNA-directed RNA synthesis:

(1) Initiation by binding of the transcription apparatus to the DNA template

(2) Elongation of the mRNA chain

(3) Termination of the mRNA chain

The piece of mRNA that results from the direct transcription of the DNA that encodes a "gene" is called the "primary transcript" and it undergoes modification, sometimes quite extensively, before it can translate its message into protein.

The class of enzymes that synthesize RNAs are known as RNA polymerases. They are all multisubunit complexes that are present in all cells and they catalyze the reaction:

(RNA)n residues + 1 NTP === (RNA)n+1 residues + PPJeg

Pyrophosphate is irreversibly hydrolyzed to 2 PJeg thus driving the reaction to the right. The individual nucleotides that are read off of the DNA template strand are transcribed into the nucleotides of the corresponding RNA, so the final result is a single-stranded polymer, namely the mRNA, whose nucleotides correspond exactly to the complementary nucleotides on the DNA strand with the exception that everywhere that a "A" appears in the DNA template strand, a "U" appears in the mRNA. (The possible NTPs, then, are ATP,CTP,GTP,UTP.)

Transcription in Prokaryotes

The most studied RNA polymerase is that from E coli, so we will study it as the prototype of the RNA polymerases. The holoenzyme is a 449 kD protein composed of a "core enzyme" and a " s -subunit", and the entire complex is denoted (core) s. The core enzyme directs the polymerization reaction, and it has 4 subunits: core enzyme = a2bb ' w. T he inorganic ions Zn 2+ (two of them in the b ' subunit) and Mg 2+ are required for catalytic activity and the three-dimensional structure of the enzyme resembles a hand. The thumb of the hand can be envsioned as grasping a piece of B DNA that lies in a channel represented by the curved fingers and palm of the hand. This channel is cylindrical, with dimensions on the order of 25 A by 55 A. These dimensions allow a fit of about 16 base pairs of B DNA.

The "hand" structure appears in other enzymes that we will study, including DNA polymerase and reverse transcriptase. You can further study the hand structure of RNA polymerase by looking at T7 RNA polymerase (see PDB below).

We will look at transcription from the point of view of the gene, which we have already mentioned is a rather ambiguous entity. Nevertheless, it is clear that there must be a starting point for correct transcription to take place, and it is reasonable to include this as part of the gene, even though it does not get transcribed itself. So, the problem of initiation is really one of recognition of a starting point. But which of the two strands of the DNA serves as the template and how does the polymerase choose?

Either strand can serve as the template but the transcription always proceeds from the 5' end of a strand of DNA to the 3' end. The 3'-5' strand that serves as the template is called the "antisense" or noncoding strand and the 5'-3' strand (which has the same nucleotide sequence, with exception of "U"s for "T"s, as the subsequently transcribed mRNA) is the "sense" or "coding" strand. To be consistent and clear, we will use the convention that our description of position along a sequence of nucleotides will be from the point of view of the sense strand, as this is the same ordering as that of the mRNA that is transcribed. The part of the gene that serves as the initiation site is called the "promoter" and it is sought out by the RNA polymerase holoenzyme. The holoenzyme binds weakly to DNA, with a Kdissoc of about 10 -7 M, and this allows it to move along the antisense strand in search of the promoter. The s subunit is specific for its promoter sequence and tight binding of the holoenzyme occurs (Kdissoc of about 10 -14 M).

The promoter is recognized by an approximately 40 bp nucleotide sequence on the 5' side of the initiation site, and within this sequence are two "conserved" sequences. One of these is 6 bp in length and is centered about 10 bps upstream from the starting site of transcription. This is the "Pribnow Box" and it has a consensus sequence TATAAT . The other, less highly conserved, sequence is centered about 35 bp upstream and has a consensus sequence of TTGACA . The start site is indicated by the notation +1 and is almost always EN eller G .

RNA polymerase holoenzyme contacts the promoter at roughly the centers of the two regions (-10 and -35) and the core enzyme tightly binds to the duplex DNA. Its action is that of melting the double-stranded DNA along a sequence of about 11 bps, from -9 to +2. The s factor splits off as transcription begins.

It is the specific s factors within a cell that determine which genes will be transcribed. Thus individual cell types are characterized by their s factors.

Chain elongation proceeds in the 5'--> 3' direction, and the "transcription bubble" (the length of "melted" DNA) travels with the RNA polymerase. As a consequence, the unmelted DNA is overwound in front of the bubble and underwound behind the bubble. Topoisomerases then act to relax the positive and negative supercoils. The mRNA that is produced is hybridized for a short length to the DNA at the downstream position, and exists separate from the DNA as a "tail", the point of attachment being at the downstream end. The RNA polymerase does not fall off of the DNA as it is processing because of its relatively tight, but nonspecific, binding on both sides of the transcription bubble, stabilized by its "thumb" wrapping around the DNA. About 20 to 50 nucleotides are transcribed per second at 37 C and one nucleotide is incorrectly transcribed in about every 10 4 . As genes are repeatedly transcribed, this error rate is not too deleterious, especially when coupled with the fact that there are multiple codons ("synonyms") for each amino acid subsequently translated and that single amino acid substitution errors in a protein usually do not hinder its function.

Spontaneous termination of gene transcription is signaled by "termination sequences".In E coli, the final signal to stop transcription is a series of 4 - 10 A-T base pairings with the EN s on the template strand. For hver EN in this region, the mRNA transcript will have a U . Just upstream from this sequence is a region rich in G og C bases followed by a spacer of nucleotides and another region rich in G og C . The two G , C rich regions are such that one region can be superimposed upon the other by a symmetry operation of 180 o . This relationship of base pairs around a center of rotational symmetry is called a "palindromic sequence". The resulting string of nucleotides at the 3' end of the mRNA is such that a hairpin loop can form, the G s base-pairing with the C s and vice versa, and the As with the Us. The most terminal part of the 3' end is a series of U s followed by a hydroxyl group. As the loop is forming, the RNA polymerase pauses at the termination site. The terminal oligo- U tail, which is only weakly bound to the DNA template strand, is displaced by the non-template DNA strand. Now the mRNA strand is free of the DNA template. However, there are numerous other factors that influence the overall process of termination.

Nonspontaneous termination of transcription requires a "rho factor" protein, which also functions to improve the spontaneous termination efficiency. The rho factor recognizes a sequence on the growing mRNA chain, upstream from the termination site, after which it attaches and moves along the chain in the 5'-3' direction until it reaches the RNA polymerase that is paused at the termination site. The transcript is released from its template strand by the unwinding of RNA-DNA duplex by the rho factor.

Transcription in Eukarytes:

While very similar to that in prokaryotes, the "machinery" and control sequences of transcription in eukaryotes is much more complex, and there are numerous RNA polymerases.

Ribosomal RNA (rRNA) constitutes about 95% of all RNA and about 67% of the RNA in ribosomes. The remainder of RNA includes transfer RNA (tRNA), messenger RNA (mRNA) and other types present in smaller amounts, like "small nuclear" RNAs (snRNAs) involved in mRNA splicing and "guide" RNAs that are involved in editing of RNA. These latter two processes occur in the post-translation stage of the life cycle of eukaryotic mRNA. All RNAs are coded for by DNA, and the different types of RNA polymerase in eukaryotes reflect this and the fact that, in eukaryotes, translation of mRNA into DNA occurs outside of the nucleus.

Precursors of most rRNA are synthesized in nucleoli with the enzyme RNA polymerase I. Precursors of mRNA are synthesized in the nucleoplasm by RNA polymerase II while RNA polymerase III, also in the nucleoplasm, synthesizes precursors of 5S RNA, tRNAs and other RNAs found both in the nucleus and cytoplasm. Mitochondria have their own RNA polymerases, and these are analogous to chloroplast RNAs found in plants. We will focus on RNA polymerase II as it is the one involved in transcription in eukaryotes.

You can look at the structure of yeast RNA polymerase II (see PDB below) as we discuss its structure as a prototype. These are large, multisubunit enzymes, with some of the subunits being homologs of the a,b, and b ' subunits in the prokaryotic RNA polymerase. The overall shape of the enzyme is similar to that of the prokaryotic RNA polymerase ( and DNA polymerase), namely that of a hand with a "thumb" motif that flanks a channel big enough to contain a piece of B-DNA (about 25 A wide).

We did not yet consider the chemistry of the elongation of the mRNA chain, but we will do so here. The chains are elongated in the direction 5' --> 3' by nucleophilic attack of the 3' OH group of the growing chain by the a- phosphate of the incoming NTP.

As in prokaryotes, eukaryotic transcription begins by recognition of promoters. There are many copies of the rRNA genes that direct rRNA synthesis, all with almost identical sequences. This redundancy assures an adequate supply of rRNA which, as we mentioned previously, comprises about 95% of cellular RNA. The promoters for these almost identical genes are, therefore, identical, so RNA polymerase I must only recognize one promoter sequence. However, the RNA polymerase I is species-specific (RNA poly II and III are not species specific).

For promotion of mammalian rRNA,, there is a "core promoter element" that spans the region -31 to +6 (note that this overlaps a region of the gene that is transcribed) and an "upstream promoter element" that spans -187 to -107.

For transcription of genes by RNA polymerase III, the promoter is sometimes located in a segment within the transcribed part of the gene, between +40 and +80, but can also be partially upsteam or entirely upstream fro the start site.

RNA Polymerase II Promoters and Control Sequences

Promoter sequences for RNA polymerase II are diverse. We can divide these into two classes: those that are found in genes that produce proteins at about the same rate in all cells ( "constitutive enzymes") and those for genes whose production rates vary greatly from one cell type to another and depend upon the needs of a differentiated cell at a given time ("inducible enzymes").

Constitutive Gene Promoter Elements:

De GC Box : This is a region containing one or more copies of the sequence GGGCGG (or its complement) in a location upstream from the start site, and it is analogous to the prokaryotic promoter elements.

Other promoter elements are also found in the -50 to - 110 region upstream from the GC box.

Selectively Expressed Gene Promoter Elements:

De TATA Box : A region located at about -25 to -30 that is rich in the nucleotides "A" and "T" and that resembles the Pribnow Box (TATAAT). Genes can still be transcribed in the presence of a defective TATA box and it is thought that the TATA box is involved in choosing the transcription start site

De CCAAT Box : This is a sequence that is often found upstream to the TATA box, located at about -70 to -90. These bind RNA polymerase II as well as other proteins needed for initiation of transcription.

Control Sequences for Structural Genes:

Other regions of the chromosome, some far-removed from the start site, can affect the binding of RNA polymerase II to promoter elements. These gene elements are called "enhancers" and "silencers". Proteins called "activators" and "repressors" can bind to the enhancers and silencers , thus affecting polymerase binding to the promoters. Furthermore, the same protein can function as both an activator or a repressor, depending upon the specific interaction ("dual-acting" transcription factors).

Recruitment of RNA Polymerase II to the Promoter:

Eukaryotes do not have a simple protein that corresponds to the s factor in prokaryotes. Rather, there is a set of proteins that together perform the same function as the s factor, and these are the "general transcription factors" ("GTFs"). We have already looked at structures of transcription factors when we discussed DNA-protein interaction in a previous lecture. Otherwise, the general mechanisms of transcription initiation are similar.

There are 6 GTFs that are required for a low and invariant basal rate of transcription, and this rate can be increased by the participation of other protein factors. These GTFs form a "preinitiation complex" that begins when the "TATA binding protein" ("TBP") binds to the TATA box (if there is one) of a promoter. The specific sequence at which it binds identifies the transcription start site. As a result of this binding, the DNA is distorted by kinks at both ends of the TATA box. Other GTFs bind successively, followed by the binding of RNA polymerase. Finally, the remaining GTFs bind.

After TBP (which is a component of TFIID) binds, the sequence of binding is as follows:

TFIIH has two important enzyme activities. The first is an ATP-dependent helicase activity that assists the formation of an open complex and the second is a kinase activity that results in the phosphorylation of the largest subunit of RNA polymerase II at its C-terminal end. Now the transcription elongation process can begin, with the various GTFs (except TFIIF) dissociating from the complex as elongation occurs. TFIID remains bound to the promoter so that repeated transcription can occur as GTFs reassemble to form the preinitiation complex.

This discussion has focused on RNA polymerase II different transcription factors are needed for RNA polymerases I and III. However, all three require TBP.

Cells control the transcription of every gene individually. A unique combination of silencers and enhancers for each gene modulates the transcription rate. How do activator and repressor proteins that are bound far from the promoter influence that transcription of genes?

"Specificity protein 1" (Sp1) was the first menneskelig transcription factor that was found that could recognize a specific GC regulatory enhancer sequence. This protein has two interesting modules:

(1) A module of 3 zinc fingers at one end

(2) A module at the opposite end with 2 discrete segments rich in Gln.

Mutants that do not have the glutamine-rich end can bind to DNA but transcription is not stimulated. Therefore, the glutamine-rich end must need to bind to something else for transcription to occur, and these are the "coactivators". They are also called "TBP-Assicuated Factors" or "TAFs" and there are at least eight of them that are important to transcriptional activation. These are not basal factors (GTFs) and they do not bind to specific DNA sequences. Rather, they bind avidly to TBP and provide for multiple "docking sites" to the activators. In this sense, they are "adaptor molecules". A "toolkit" of such adaptor molecules provides for tremendous diversity of options to modulate transcription of a gene. So, expanding on our previous comparison of the preinitiation complex of GTFs to the prokaryotic s factor, a better comparison would be between the s factor and the entire complex of activator-coactivator-basal preinitiation complex. As to how this arrangement modulates of influences the rate of transcription, it is probably mediated primarily by distortion of DNA that facilitates the movement of RNA polymerase II along the coding region.

Latchman (TRENDS in Biochemical Sciences Vol. 26 No.4 April 2001) has pointed out the importance of the DNA binding site itself as playing a key role in transcriptional modulation. The same transcription factor can assume different conformations as a result if binding to different sites. The conformational changes are induced by the DNA-protein interaction, thereby increasing the flexibility of the spectrum of control of transcription, since one protein can act like an entire collection of proteins, each having its own effect (activation, inhibition or no effect).

To carry this one step further, one can imagine that a similar phenomenon can occur when coactivators bind to activators. Perhaps different conformational changes are similarly induced in the bound protein depending upon type of protein-protein interaction. Such conformational changes can then result in different ability to modulate transcription.

The activation domains of transcription factors are often glutamine-rich, but others are proline-rich or acidic. In some cases, hydrophobic residues are interspersed among the acidic or glutamine residues and are important for activation. Tjian (Cell, Vol. 77, 5-8, April 8, 1994) suggests that hydrophobic forces drive cohesion of activation domains with their targets and that specificity is achieved by the periodicity of the cohesive elements.

Genes are transcribed at measurable rates only if the correct activators are present and are able to overcome the effects of repressors.


Se videoen: From DNA to protein - 3D (August 2022).